Browse wiki
| Sequence 658 (CD11C) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Integrin, alpha X ( complement component 3 … Integrin, alpha X ( complement component 3 receptor 4 subunit ) Ensembl: ENSG00000102678 UniGene: Hs.248472 EntrezGene: 3687 Ensembl Chr13: 21143875 - 21174187 Strand: 1 GO terms: 0000074 0001525 0001649 0002053 0002062 0005615 0006606 0007165 0007267 0007275 0008083 0008201 0008283 0008543 0008584 0030154 0030178 0030238 0030324 0030326 0030949 0042472 004574338 0030324 0030326 0030949 0042472 0045743 |
| Design | SiRNA + |
| Name | CD11C + |
| Sequence | siRNA sense (21b) GCCCTCCCAGGAACACATATT / siRNA antisense (21b) TATGTGTTCCTGGGAGGGCTT |
| Target | ITGAX ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:49 + |
| hide properties that link here |
| No properties link to this page. |
