Browse wiki
| Sequence 679 (K14-1(4), K141(4) ) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Keratin 14 ( epidermolysis bullosa simplex, Dowling-Meara, Koebner ) Ensembl: ENSG00000186847 UniGene: Hs.654380 EntrezGene: 3861 Ensembl Chr17: 36992059 - 36996673 Strand: -1 GO terms: 0005198 0005200 0005515 0008544 0030855 0045095 |
| Design | SiRNA + |
| Name | K14-1(4), K141(4) + |
| Sequence | siRNA sense (21b) GGATGCCGAGGAATGGTTCTT / siRNA antisense (21b) GAACCATTCCTCGGCATCCTT |
| Target | KRT14 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:18 + |
| hide properties that link here |
| No properties link to this page. |
