Browse wiki

Jump to: navigation, search
Sequence 684 (MO let-7 , MOlet7)
Application Gene silencing +
Chemistry PmApmApmCpmTpmApmTpmApmCpmApmApmCpmCpmTpmApmCpmTpmApmCpmCpmTpmCpmA +
Description let7
Design Morpholino +
Name MO_let-7 , MOlet7  +
Sequence (22b) AACTATACAACCTACTACCTCA
Target Let-7 ( Danio rerio ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:07  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders