Browse wiki
| Sequence 708 (LMO4 276-mut , LMO4276mut) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | LIM domain only 4 Ensembl: ENSG00000143013 UniGene: Hs.436792 EntrezGene: 8543 Ensembl Chr1: 87566739 - 87587021 Strand: 1 GO terms: 0001843 0003700 0005667 0006350 0006355 0006366 0008134 0008270 0046872 |
| Design | SiRNA + |
| Name | LMO4_276-mut , LMO4276mut + |
| Sequence | siRNA sense (21b) GTCCATTTCTCGGCGTTAATT / siRNA antisense (21b) TTAACGCCGAGAAATGGACTT |
| Target | LMO4 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:49 + |
| hide properties that link here |
| No properties link to this page. |
