Browse wiki
| Sequence 730 (ISIS-399479 , ISIS 399479) |
| Application | Gene silencing + |
|---|---|
| Chemistry | MoC*moG*moG*moT*moG*C*A*A*G*G*C*T*T*A*G*moG*moA*moA*moT*moT + |
| Description | Metastasis associated lung adenocarcinoma transcript 1 ( non-coding RNA ) Ensembl: ENSMUSG00000092341 UniGene: Mm.298256 EntrezGene: 72289 |
| Design | MOE gapmer + |
| Name | ISIS-399479 , ISIS 399479 + |
| Sequence | CGGTGCAAGGCTTAGGAATT |
| Target | Malat1 ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:37 + |
| hide properties that link here |
| No properties link to this page. |
