Browse wiki
| Sequence 738 (shMEK2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Mitogen-activated protein kinase kinase 2 Ensembl: ENSG00000126934 UniGene: Hs.465627 EntrezGene: 5605 Ensembl Chr19: 4041319 - 4075126 Strand: -1 GO terms: 0000166 0004672 0004674 0004713 0005515 0005524 0005576 0006468 0016740 |
| Design | ShRNA + |
| Name | shMEK2 + |
| Sequence | (64b) GATCCCGAAGGAGAGCCTCACAGCATTCAAGAGATGCTGTGAGGCTCTCCTTCTTTTTTGGAAA |
| Target | MAP2K2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:18 + |
| hide properties that link here |
| No properties link to this page. |
