Browse wiki
| Sequence 755 (jnk2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Mitogen-activated protein kinase 9 Ensembl: ENSG00000050748 UniGene: Hs.654461 EntrezGene: 5601 Ensembl Chr5: 179595388 - 179640218 Strand: -1 GO terms: 0000166 0004672 0004674 0004705 0004707 0004713 0005515 0005524 0006468 0006950 0007254 0016740 |
| Design | ShRNA + |
| Name | jnk2 + |
| Sequence | (64b) GATCCCCGCCGTCCTTTTCAGAACCATTCAAGAGATGGTTCTGAAAAGGACGGCTTTTTGGAAA |
| Target | MAPK9 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:19 + |
| hide properties that link here |
| No properties link to this page. |
