Browse wiki
Sequence 763 (MEN1-7) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Multiple endocrine neoplasia I Ensembl: ENSG00000133895 UniGene: Hs.423348 EntrezGene: 4221 Ensembl Chr11: 64327564 - 64335342 Strand: -1 GO terms: 0000122 0003677 0005515 0005634 0005829 0006355 0016571 0030528 0032154 0035097 0045941 |
Design | SiRNA + |
Name | MEN1-7 + |
Sequence | siRNA sense (21b) AGAAGGTCTCCGATGTCATTT / siRNA antisense (21b) ATGACATCGGAGACCTTCTTT |
Target | MEN1 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:07 + |
hide properties that link here |
No properties link to this page. |