Browse wiki

Jump to: navigation, search
Sequence 878 (miR7 , miR7)
Application Gene silencing +
Chemistry PmApmApmCpmApmApmApmApmTpmCpmApmCpmTpmApmGpmTpmCpmTpmTpmCpmCpmA +
Description miR7
Design Morpholino +
Name miR7 , miR7  +
Sequence (21b) AACAAAATCACTAGTCTTCCA
Target MiR7 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:21:14  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders