Browse wiki
| Sequence 889 (MSH2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | MutS homolog 2, colon cancer, nonpolyposis … MutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) Ensembl: ENSG00000095002 UniGene: Hs.597656 EntrezGene: 4436 Ensembl Chr2: 47483767 - 47563864 Strand: 1 GO terms: 0000166 0000287 0000400 0001701 0003684 0003697 0004422 0005524 0005634 0006119 0006164 0006284 0006298 0006301 0006915 0006928 0007049 0007050 0008340 0010165 0010224 0016446 001644750 0008340 0010165 0010224 0016446 0016447 |
| Design | SiRNA + |
| Name | MSH2 + |
| Sequence | siRNA sense (21b) GACCCAGGGGGTGATCAAGTT / siRNA antisense (21b) CTTGATCACCCCCTGGGTCTT |
| Target | AGFG1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:35 + |
| hide properties that link here |
| No properties link to this page. |
