Browse wiki
| Sequence 891 (RNAc) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Myosin IC Ensembl: ENSG00000197879 UniGene: Hs.286226 EntrezGene: 4641 Ensembl Chr17: 1314875 - 1342745 Strand: -1 GO terms: 0000166 0003774 0003779 0005516 0005524 0005737 0005902 0009925 0016328 0016459 0016461 0017111 0031941 |
| Design | SiRNA + |
| Name | RNAc + |
| Sequence | siRNA sense (21b) GGTCCCCATCCTCAAGAGGTT / siRNA antisense (21b) CCTCTTGAGGATGGGGACCTT |
| Target | MYO1C ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:07 + |
| hide properties that link here |
| No properties link to this page. |
