Browse wiki
| Sequence 900 (hCAP-D3 (RD3-1) , hCAPD3 (RD31) ) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Non-SMC condensin II complex, subunit D3 Ensembl: ENSG00000151503 UniGene: Hs.438550 EntrezGene: 23310 Ensembl Chr11: 133527547 - 133599636 Strand: -1 GO terms: 0000799 0005634 0007049 0007067 0007076 0051301 |
| Design | SiRNA + |
| Name | hCAP-D3 (RD3-1) , hCAPD3 (RD31) + |
| Sequence | siRNA sense (21b) CTGGATTTCACAGAGACTGTT / siRNA antisense (21b) CAGTCTCTGTGAAATCCAGTT |
| Target | NCAPD3 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:51 + |
| hide properties that link here |
| No properties link to this page. |
