Browse wiki
Sequence 907 (hCAP-H (RH-2) , hCAPH (RH2) ) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Non-SMC condensin I complex, subunit H Ensembl: ENSG00000121152 UniGene: Hs.308045 EntrezGene: 23397 Ensembl Chr2: 96365211 - 96405001 Strand: 1 GO terms: 0000278 0005634 0005737 0007067 0007076 0051301 |
Design | SiRNA + |
Name | hCAP-H (RH-2) , hCAPH (RH2) + |
Sequence | siRNA sense (21b) CATTACTCCACCTGTATCATT / siRNA antisense (21b) TGATACAGGTGGAGTAATGTT |
Target | NCAPH ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:51 + |
hide properties that link here |
No properties link to this page. |