Browse wiki
| Sequence 908 (hCAP-H2 (RH2-1) , hCAPH2 (RH21) ) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Non-SMC condensin II complex, subunit H2 Ensembl: ENSG00000025770 UniGene: Hs.180903 EntrezGene: 29781 Ensembl Chr22: 49293532 - 49308767 Strand: 1 |
| Design | SiRNA + |
| Name | hCAP-H2 (RH2-1) , hCAPH2 (RH21) + |
| Sequence | siRNA sense (21b) GGATTTCAGGATGAACACGTT / siRNA antisense (21b) CGTGTTCATCCTGAAATCCTT |
| Target | NCAPH2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:47 + |
| hide properties that link here |
| No properties link to this page. |
