Browse wiki
| Sequence 917 (Nek6 |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | NIMA ( never in mitosis gene a )-related k … NIMA ( never in mitosis gene a )-related kinase 6 Ensembl: ENSG00000119408 UniGene: Hs.197071 EntrezGene: 10783 Ensembl Chr9: 126059706 - 126155407 Strand: 1 GO terms: 0000166 0000287 0004672 0004674 0004713 0004871 0005515 0005524 0005634 0005737 0006468 0006915 0007049 0007059 0007067 0016740 0030071 0043123 005130159 0007067 0016740 0030071 0043123 0051301 |
| Design | SiRNA + |
| Name | Nek6#2 + |
| Sequence | siRNA sense (21b) GCTCGGTGACCTTGGTCTGTT / siRNA antisense (21b) CAGACCAAGGTCACCGAGCTT |
| Target | NEK6 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:42 + |
| hide properties that link here |
| No properties link to this page. |
