Browse wiki
| Sequence 922 (siNrf2 |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Nuclear factor ( erythroid-derived 2 )-lik … Nuclear factor ( erythroid-derived 2 )-like 2 Ensembl: ENSG00000116044 UniGene: Hs.155396 EntrezGene: 4780 Ensembl Chr2: 177803279 - 177965671 Strand: -1 GO terms: 0003677 0003700 0005634 0005737 0006355 0006366 0016563 0030968 0043565 0045449 0045893 0045995 004698368 0043565 0045449 0045893 0045995 0046983 |
| Design | ShRNA + |
| Name | siNrf2#3 , siNrf2#3 + |
| Sequence | (49b) GTCCCAGTGTGGCATCACCTTCAAGAGAGGTGATGCCACACTGGGACTT |
| Target | NFE2L2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:54 + |
| hide properties that link here |
| No properties link to this page. |
