Browse wiki
| Sequence 932 (siNME1.1) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Non-metastatic cells 1, protein (NM23A) ex … Non-metastatic cells 1, protein (NM23A) expressed in Ensembl: ENSG00000011052 UniGene: Hs.463456 EntrezGene: 4830 Ensembl Chr17: 46585919 - 46604107 Strand: 1 GO terms: 0000166 0000287 0001726 0003677 0003700 0004536 0004550 0005515 0005524 0005634 0005737 0006183 0006228 0006241 0006350 0006355 0007049 0007155 0008285 0009117 0009142 0009209 001630155 0008285 0009117 0009142 0009209 0016301 |
| Design | SiRNA + |
| Name | siNME1.1 + |
| Sequence | siRNA sense (21b) AGTTGGCAGGAACATTATATT / siRNA antisense (21b) TATAATGTTCCTGCCAACTTG |
| Target | NME1 (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:42 + |
| hide properties that link here |
| No properties link to this page. |
