Browse wiki
Sequence 937 (scrambled) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Control |
Design | SiRNA + |
Name | scrambled + |
Sequence | siRNA sense (20b) CCGTCGATTTCACCCGGGTT / siRNA antisense (20b) CCCGGGTGAAATCGACGGTT |
Target | None + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:43 + |
hide properties that link here |
No properties link to this page. |