Browse wiki

Jump to: navigation, search
Sequence 956 (ISIS-141923 , ISIS 141923)
Application Gene silencing +
Chemistry MoC*moC*moT*moT*moC*C*C*T*G*A*A*G*G*T*T*moC*moC*moT*moC*moC +
Description Control
Design MOE gapmer +
Name ISIS-141923 , ISIS 141923  +
Sequence CCTTCCCTGAAGGTTCCTCC
Target None +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 10 July 2015 01:35:27  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders