Browse wiki
| Sequence 978 (shSmad4 4 , shSmad44) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Neuropeptide Y |
| Design | ShRNA + |
| Name | shSmad4_4 , shSmad44 + |
| Sequence | (49b) GCACGTCAAGTATTGCCAGTTCAAGAGACTGGCAATACTTGACGTGCTT |
| Target | NPY ( Gallus gallus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:56 + |
| hide properties that link here |
| No properties link to this page. |
