Browse wiki
| Sequence 994 (OGT2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | O-linked N-acetylglucosamine ( GlcNAc ) tr … O-linked N-acetylglucosamine ( GlcNAc ) transferase ( UDP-N-acetylglucosamine:polypeptide-N-acetylglucosaminyl transferase ) Ensembl: ENSMUSG00000034160 UniGene: Mm.259191 EntrezGene: 108155 Ensembl ChrX: 98835403 - 98879688 Strand: 1 GO terms: 0005515 0005622 0005634 0005737 0006396 0006493 0008080 001675734 0005737 0006396 0006493 0008080 0016757 |
| Design | SiRNA + |
| Name | OGT2 + |
| Sequence | siRNA sense (21b) GTTTGAGCCCAAATCATGCTT / siRNA antisense (21b) GCATGATTTGGGCTCAAACTT |
| Target | Ogt ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:05 + |
| hide properties that link here |
| No properties link to this page. |
