Browse wiki

Jump to: navigation, search
Sequence 1034(pol beta 3 , polbeta3)
Application Gene silencing +
Chemistry RNA +
Description Polymerase ( DNA directed ), beta EnsemblPolymerase ( DNA directed ), beta Ensembl: ENSMUSG00000031536 UniGene: Mm.123211 EntrezGene: 18970 Ensembl Chr8: 23738604 - 23763897 Strand: -1 GO terms: 0000287 0000795 0003677 0003684 0003824 0003887 0003890 0003912 0005622 0005634 0005737 0005876 0006260 0006281 0006287 0006290 0006916 0008017 0008219 0016740 0016829 0017125 003140217 0008219 0016740 0016829 0017125 0031402
Design ShRNA +
Name pol_beta_3 , polbeta3  +
Sequence (64b) TCGAGCCTCAATGAGTACACCATCCGTTCAAGAGACGGATGGTGTACTCATTGATTTTTGGAAA
Target Polb ( Mus musculus ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:56  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders