Browse wiki
Sequence 1035(LSDP5) |
Application | Gene expression + |
---|---|
Chemistry | DNA + |
Description | Peroxisome proliferator-activated receptor … Peroxisome proliferator-activated receptor gamma Ensembl: ENSG00000132170 UniGene: Hs.162646 EntrezGene: 5468 Ensembl Chr3: 12304070 - 12450855 Strand: 1 GO terms: 0000122 0003677 0003700 0003707 0004872 0004879 0005515 0005634 0005829 0006091 0006350 0006355 0006629 0007165 0007584 0008270 0016563 0016564 0030855 0043565 0045165 0045600 004594164 0030855 0043565 0045165 0045600 0045941 |
Design | Primer set + |
Name | LSDP5 + |
Sequence | Forward PCR primer (21b) AGCACGATGTCTGAAGAAGAG / Reverse PCR primer (20b) TCCTTGGCTGCACTGTAAAC |
Target | PPARG ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:06 + |
hide properties that link here |
No properties link to this page. |
![Support Doctors Without Borders](http://www.doctorswithoutborders.org/sites/usa/files/button_popup_185x70.png)