Browse wiki

Jump to: navigation, search
Sequence 1035(LSDP5)
Application Gene expression +
Chemistry DNA +
Description Peroxisome proliferator-activated receptor … Peroxisome proliferator-activated receptor gamma Ensembl: ENSG00000132170 UniGene: Hs.162646 EntrezGene: 5468 Ensembl Chr3: 12304070 - 12450855 Strand: 1 GO terms: 0000122 0003677 0003700 0003707 0004872 0004879 0005515 0005634 0005829 0006091 0006350 0006355 0006629 0007165 0007584 0008270 0016563 0016564 0030855 0043565 0045165 0045600 004594164 0030855 0043565 0045165 0045600 0045941
Design Primer set +
Name LSDP5  +
Sequence Forward PCR primer (21b) AGCACGATGTCTGAAGAAGAG / Reverse PCR primer (20b) TCCTTGGCTGCACTGTAAAC
Target PPARG ( Homo sapiens ) +
Categories Sequence  +
Modification¬†dateThis property is a special property in this wiki. 2 March 2015 02:21:06  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders