Browse wiki
| Sequence 1042(PKCd) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Protein kinase C, delta Ensembl: ENSG0000 … Protein kinase C, delta Ensembl: ENSG00000163932 UniGene: Hs.155342 EntrezGene: 5580 Ensembl Chr3: 53170263 - 53201771 Strand: 1 GO terms: 0000166 0004672 0004674 0004701 0004713 0005524 0005634 0005737 0006468 0006917 0007242 0008022 0008047 0008270 0016020 0016064 0016301 0016740 0019899 0019992 0032613 0032615 004210040 0019899 0019992 0032613 0032615 0042100 |
| Design | SiRNA + |
| Name | PKCd + |
| Sequence | siRNA sense (21b) AGTACTTGGCAAAGGCAGCTT / siRNA antisense (21b) GCTGCCTTTGCCAAGTACTTT |
| Target | Prkcd ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:26 + |
| hide properties that link here |
| No properties link to this page. |
