Browse wiki

Jump to: navigation, search
Sequence 1045(PSEN1)
Application Gene silencing +
Chemistry RNA +
Description Presenilin 1 ( Alzheimer disease 3 ) Ense … Presenilin 1 ( Alzheimer disease 3 ) Ensembl: ENSG00000080815 UniGene: Hs.592324 EntrezGene: 5663 Ensembl Chr14: 72672908 - 72756862 Strand: 1 GO terms: 0000776 0001568 0001708 0001756 0001764 0004175 0005515 0005622 0005624 0005634 0005639 0005739 0005783 0005794 0005887 0006509 0006874 0006915 0006916 0007001 0007059 0007155 000722015 0006916 0007001 0007059 0007155 0007220
Design SiRNA +
Name PSEN1  +
Sequence siRNA sense (21b) GGTCCACTTCGTATGCTGGTT / siRNA antisense (21b) CCAGCATACGAAGTGGACCTT
Target PSEN1 ( Homo sapiens ) +
Categories Sequence  +
Modification¬†dateThis property is a special property in this wiki. 2 March 2015 02:20:47  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders