Browse wiki
| Sequence 1047(ISIS-116847 , ISIS 116847) |
| Application | Gene silencing + |
|---|---|
| Chemistry | MoC*moT*moG*moC*moT*A*G*C*C*T*C*T*G*G*A*moT*moT*moT*moG*moA + |
| Description | Phosphatase and tensin homolog ( mutated i … Phosphatase and tensin homolog ( mutated in multiple advanced cancers 1 ) Ensembl: ENSG00000171862 UniGene: Hs.500466 EntrezGene: 5728 Ensembl Chr10: 89613175 - 89718511 Strand: 1 GO terms: 0000079 0001525 0004438 0004722 0004725 0005161 0005515 0005737 0006470 0006629 0006917 0007049 0007417 0007507 0008138 0008283 0008285 0008289 0016311 0016314 0016787 0016791 003016589 0016311 0016314 0016787 0016791 0030165 |
| Design | MOE gapmer + |
| Name | ISIS-116847 , ISIS 116847 + |
| Sequence | CTGCTAGCCTCTGGATTTGA |
| Target | Pten ( Homo sapiens / Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:17 + |
| hide properties that link here |
| No properties link to this page. |
