Browse wiki

Jump to: navigation, search
Sequence 1047(ISIS-116847 , ISIS 116847)
Application Gene silencing +
Chemistry MoC*moT*moG*moC*moT*A*G*C*C*T*C*T*G*G*A*moT*moT*moT*moG*moA +
Description Phosphatase and tensin homolog ( mutated i … Phosphatase and tensin homolog ( mutated in multiple advanced cancers 1 ) Ensembl: ENSG00000171862 UniGene: Hs.500466 EntrezGene: 5728 Ensembl Chr10: 89613175 - 89718511 Strand: 1 GO terms: 0000079 0001525 0004438 0004722 0004725 0005161 0005515 0005737 0006470 0006629 0006917 0007049 0007417 0007507 0008138 0008283 0008285 0008289 0016311 0016314 0016787 0016791 003016589 0016311 0016314 0016787 0016791 0030165
Design MOE gapmer +
Name ISIS-116847 , ISIS 116847  +
Sequence CTGCTAGCCTCTGGATTTGA
Target Pten ( Homo sapiens / Mus musculus ) +
Categories Sequence  +
Modification¬†dateThis property is a special property in this wiki. 2 March 2015 02:21:17  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders