Browse wiki
| Sequence 1048(FAK) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | PTK2 protein tyrosine kinase 2 Ensembl: E … PTK2 protein tyrosine kinase 2 Ensembl: ENSG00000169398 UniGene: Hs.395482 EntrezGene: 5747 Ensembl Chr8: 141737683 - 142080514 Strand: -1 GO terms: 0000166 0000226 0001525 0001568 0001570 0001764 0004672 0004674 0004713 0005515 0005524 0005856 0005925 0006468 0007229 0016324 0016740 0030027 0030054 0030198 0040023 0042169 004354227 0030054 0030198 0040023 0042169 0043542 |
| Design | SiRNA + |
| Name | FAK + |
| Sequence | siRNA sense (21b) CCACCTGGGCCAGTATTATTT / siRNA antisense (21b) ATAATACTGGCCCAGGTGGTT |
| Target | PTK2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:20 + |
| hide properties that link here |
| No properties link to this page. |
