Browse wiki

Jump to: navigation, search
Sequence 1072(RB
Application Gene silencing +
Chemistry RNA +
Description Retinoblastoma 1 ( including osteosarcoma Retinoblastoma 1 ( including osteosarcoma ) Ensembl: ENSG00000139687 UniGene: Hs.408528 EntrezGene: 5925 Ensembl Chr13: 47775884 - 47954027 Strand: 1 GO terms: 0000075 0000082 0000122 0000279 0000785 0003700 0003713 0005515 0005634 0005667 0005819 0006350 0006469 0007049 0007050 0008134 0008285 0016564 0016568 0016605 0019900 0030308 003052164 0016568 0016605 0019900 0030308 0030521
Design ShRNA +
Name RB#2  +
Sequence (49b) ATGGAAGATGATCTGGTGATTCAAGAGATCACCAGATCATCTTCCATTT
Target RB1 ( Homo sapiens ) +
Categories Sequence  +
Modification dateThis property is a special property in this wiki. 2 March 2015 02:20:48  +
hide properties that link here 
  No properties link to this page.
 

 

Enter the name of the page to start browsing from.
Support Doctors Without Borders