Browse wiki
| Sequence 1088(siRHOC.2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Ras homolog gene family, member C Ensembl … Ras homolog gene family, member C Ensembl: ENSG00000155366 UniGene: Hs.502659 EntrezGene: 389 Ensembl Chr1: 113045272 - 113051548 Strand: -1 GO terms: 0000166 0003924 0004871 0005515 0005525 0005622 0005634 0005886 0006096 0006886 0006913 0007165 0007264 0015031 0016616 0043123 004426265 0007264 0015031 0016616 0043123 0044262 |
| Design | SiRNA + |
| Name | siRHOC.2 + |
| Sequence | siRNA sense (21b) CTACTGTCTTTGAGAACTATT / siRNA antisense (21b) TAGTTCTCAAAGACAGTAGGG |
| Target | RHOC (Homo sapiens) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:50 + |
| hide properties that link here |
| No properties link to this page. |
