Browse wiki
| Sequence 1113(ISIS-353382 , ISIS 353382) |
| Application | Gene silencing + |
|---|---|
| Chemistry | MoG*moC*moT*moT*moC*A*G*T*C*A*T*G*A*C*T*moT*moC*moC*moT*moT + |
| Description | Scavenger receptor class B , member 1 Ensembl: ENSMUSG00000037936 UniGene: Mm.282242 EntrezGene: 20778 |
| Design | MOE gapmer + |
| Name | ISIS-353382 , ISIS 353382 + |
| Sequence | GCTTCAGTCATGACTTCCTT |
| Target | Srb1 ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:07 + |
| hide properties that link here |
| No properties link to this page. |
