Browse wiki
| Sequence 1121(Sgo1 1 , Sgo11) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Shugoshin-like 1 ( S. pombe ) Ensembl: ENSG00000129810 UniGene: Hs.105153 EntrezGene: 151648 Ensembl Chr3: 20177091 - 20202687 Strand: -1 GO terms: 0000775 0005515 0005529 0005634 0007049 0007067 0045132 0051301 |
| Design | SiRNA + |
| Name | Sgo1_1 , Sgo11 + |
| Sequence | siRNA sense (21b) CCTGCTCAGAACCAGGAAATT / siRNA antisense (21b) TTTCCTGGTTCTGAGCAGGTT |
| Target | SGOL1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:14 + |
| hide properties that link here |
| No properties link to this page. |
