Browse wiki
Sequence 1128(siCD98-1 , siCD981) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Solute carrier family 3 (activators of dib … Solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2 Ensembl: ENSG00000168003 UniGene: Hs.502769 EntrezGene: 6520 Ensembl Chr11: 62380094 - 62412928 Strand: 1 GO terms: 0003824 0005432 0005515 0005975 0006810 0006816 0006865 0009986 0015171 0015827 0016020 0016021 0016049 004316971 0015827 0016020 0016021 0016049 0043169 |
Design | SiRNA + |
Name | siCD98-1 , siCD981 + |
Sequence | siRNA sense (21b) TCTGAAGGATGCATCCTCATT / siRNA antisense (21b) TGAGGATGCATCCTTCAGATT |
Target | SLC3A2 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:59 + |
hide properties that link here |
No properties link to this page. |