Browse wiki
Sequence 1138(hCAP-C (RC-2) , hCAPC (RC2) ) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Structural maintenance of chromosomes 4 E … Structural maintenance of chromosomes 4 Ensembl: ENSG00000113810 UniGene: Hs.58992 EntrezGene: 10051 Ensembl Chr3: 161600124 - 161635433 Strand: 1 GO terms: 0000166 0000796 0005515 0005524 0005634 0005694 0005737 0006259 0007001 0007049 0007076 0017111 0046982 0051276 005130149 0007076 0017111 0046982 0051276 0051301 |
Design | SiRNA + |
Name | hCAP-C (RC-2) , hCAPC (RC2) + |
Sequence | siRNA sense (21b) GGATGTTGGAAATCTTCTTTT / siRNA antisense (21b) AAGAAGATTTCCAACATCCTT |
Target | SMC4 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:06 + |
hide properties that link here |
No properties link to this page. |