Browse wiki
| Sequence 1143(SOCS3) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Suppressor of cytokine signaling 3 Ensembl: ENSMUSG00000053113 UniGene: Mm.3468 EntrezGene: 12702 Ensembl Chr11: 117827403 - 117830500 Strand: -1 GO terms: 0001558 0001932 0005515 0007242 0046627 |
| Design | SiRNA + |
| Name | SOCS3 + |
| Sequence | siRNA sense (21b) GGAGCAAAAGGGTCAGAGGTT / siRNA antisense (21b) CCTCTGACCCTTTTGCTCCTT |
| Target | Socs3 ( Mus musculus ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:08 + |
| hide properties that link here |
| No properties link to this page. |
