Browse wiki
Sequence 1144(SOD1i-1) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Superoxide dismutase 1, soluble ( amyotrop … Superoxide dismutase 1, soluble ( amyotrophic lateral sclerosis 1 ( adult ) ) Ensembl: ENSG00000142168 UniGene: Hs.443914 EntrezGene: 6647 Ensembl Chr21: 31953806 - 31963115 Strand: 1 GO terms: 0000187 0000303 0001541 0001819 0001890 0001895 0002262 0004785 0005507 0005615 0005634 0005737 0005739 0005759 0005777 0005829 0005886 0006302 0006309 0006749 0006801 0006879 000691602 0006309 0006749 0006801 0006879 0006916 |
Design | SiRNA + |
Name | SOD1i-1 + |
Sequence | siRNA sense (21b) TCCTCACTCTAAGAAACATTT / siRNA antisense (21b) ATGTTTCTTAGAGTGAGGATT |
Target | Sod1 ( Rattus norvegicus ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:21:28 + |
hide properties that link here |
No properties link to this page. |