Browse wiki
| Sequence 298 (Bim-2 , Bim2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | BCL2-like 11 ( apoptosis facilitator ) Ensembl: ENSG00000153094 UniGene: Hs.469658 EntrezGene: 10018 Ensembl Chr2: 111594962 - 111642493 Strand: 1 GO terms: 0005515 0005624 0006915 0006917 0008017 0016020 0043065 |
| Design | SiRNA + |
| Name | Bim-2 , Bim2 + |
| Sequence | siRNA sense (21b) GCAACCTTCTGATGTAAGTTT / siRNA antisense (21b) ACTTACATCAGAAGGTTGCTT |
| Target | BCL2L11 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:32 + |
| hide properties that link here |
| No properties link to this page. |
