Browse wiki
Sequence 298 (Bim-2 , Bim2) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | BCL2-like 11 ( apoptosis facilitator ) Ensembl: ENSG00000153094 UniGene: Hs.469658 EntrezGene: 10018 Ensembl Chr2: 111594962 - 111642493 Strand: 1 GO terms: 0005515 0005624 0006915 0006917 0008017 0016020 0043065 |
Design | SiRNA + |
Name | Bim-2 , Bim2 + |
Sequence | siRNA sense (21b) GCAACCTTCTGATGTAAGTTT / siRNA antisense (21b) ACTTACATCAGAAGGTTGCTT |
Target | BCL2L11 ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:19:32 + |
hide properties that link here |
No properties link to this page. |