Browse wiki
Sequence 353 (Cont) |
Application | Gene silencing + |
---|---|
Chemistry | RNA + |
Description | Cyclin-dependent kinase inhibitor 1A ( p21 … Cyclin-dependent kinase inhibitor 1A ( p21, Cip1 ) Ensembl: ENSG00000124762 UniGene: Hs.370771 EntrezGene: 1026 Ensembl Chr6: 36754465 - 36763086 Strand: 1 GO terms: 0000074 0000307 0004672 0004861 0005634 0005737 0005829 0006974 0007049 0007050 0008270 0008285 0008629 0009411 0016301 0030332 0030890 0043066 0043071 0045736 004687232 0030890 0043066 0043071 0045736 0046872 |
Design | SiRNA + |
Name | Cont + |
Sequence | siRNA sense (21b) ACTCTATCTGCACGCTGACTT / siRNA antisense (21b) GTCAGCGTGCAGATAGAGTTT |
Target | CDKN1A ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:36 + |
hide properties that link here |
No properties link to this page. |