Browse wiki
Sequence 461 (ISIS-445569 , ISIS 445569) |
Application | Gene silencing + |
---|---|
Chemistry | MoC*moG*moG*moA*moG*C*G*G*T*T*G*T*G*A*A*moC*moT*moG*moG*moC + |
Description | Dystrophia myotonica-protein kinase Ensembl: ENSG00000104936 UniGene: Hs.631596 EntrezGene: 1760 Ensembl Chr19: 50964818 - 50977655 Strand: -1 GO terms: 0000166 0000287 0004672 0004674 0004713 0005524 0006464 0006468 0008016 0016740 0042802 0051056 |
Design | MOE gapmer + |
Name | ISIS-445569 , ISIS 445569 + |
Sequence | CGGAGCGGTTGTGAACTGGC |
Target | DMPK ( Homo sapiens ) + |
Categories | Sequence + |
Modification dateThis property is a special property in this wiki. | 10 September 2015 08:57:52 + |
hide properties that link here |
No properties link to this page. |