Browse wiki
| Sequence 469 () |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | DNA ( cytosine-5- )-methyltransferase 1 Ensembl: ENSG00000129757 UniGene: Hs.202672 EntrezGene: 1786 Ensembl Chr11: 2861019 - 2863555 Strand: -1 GO terms: 0000079 0000080 0000122 0004861 0005515 0005634 0007049 0007050 0008285 0042551 0045735 |
| Design | SiRNA + |
| Sequence | siRNA sense (21b) CGAGTTGCTAGACCGCTTCTT / siRNA antisense (21b) GAAGCGGTCTAGCAACTCGTT |
| Target | DNMT1 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:11 + |
| hide properties that link here |
| No properties link to this page. |
