Browse wiki
| Sequence 914 (SRC2) |
| Application | Gene silencing + |
|---|---|
| Chemistry | RNA + |
| Description | Nuclear receptor coactivator 2 Ensembl: ENSG00000140396 |
| Design | SiRNA + |
| Name | SRC2 + |
| Sequence | siRNA sense (21b) GTCAGATGTATCCTCTACATT / siRNA antisense (21b) TGTAGAGGATACATCTGACTT |
| Target | NCOA2 ( Homo sapiens ) + |
| Categories | Sequence + |
| Modification dateThis property is a special property in this wiki. | 2 March 2015 02:20:45 + |
| hide properties that link here |
| No properties link to this page. |
